View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19985_high_10 (Length: 323)
Name: NF19985_high_10
Description: NF19985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19985_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 315
Target Start/End: Complemental strand, 35617923 - 35617609
Alignment:
| Q |
1 |
gtagtactagtaccatgtttaagatcttcctgcacaatactcttctcctgcactttatattcgccttcggctgttacttcctcctccaatatcccagtat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35617923 |
gtagtactagtaccatgtttaagatcttccttcacaatactcttctcctgcactttatattcgccttcggctgttacttcctcctccattatcccagtat |
35617824 |
T |
|
| Q |
101 |
cgtaaactggaaacttgactgtttttgttgctgttgatttcacagtagcactttcatcatttttcttacatgcatccatattcttgtcattccttgctct |
200 |
Q |
| |
|
|| |||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35617823 |
cgcaaaccggaaacttgactgcttttgttgctgttgatttcacagtagcactttcatcatttttcttacatgcatccatattcttgtcattccttgctct |
35617724 |
T |
|
| Q |
201 |
ctcagttacctcaaaatcccttccgtcgtttatttcttccttgctatgattcgaggaagcatcaagtgattgaatcagatttgcatgagactccaccgtt |
300 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35617723 |
ctcagttacctcaaaatcccttctgtcgtttatttcttccttgctatgattcgaggaagcatcaagtgattgaatcagatttgcatgagactccaccgtt |
35617624 |
T |
|
| Q |
301 |
gcagaagtctgtggt |
315 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
35617623 |
gcagaagtctgtggt |
35617609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University