View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19986_low_3 (Length: 299)
Name: NF19986_low_3
Description: NF19986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19986_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 33 - 292
Target Start/End: Complemental strand, 37555522 - 37555263
Alignment:
| Q |
33 |
tgcttgactttttctgcatccaatttttgtgaaaccaaacatagcacaatgcaaacaagtaacaacactcatgcaaatgcaaacgnnnnnnnntaaaagc |
132 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37555522 |
tgcttgactttttctgcatgcaatttttgtgaaaccaaacatagcataatgcaaacaagtaacaacactcatgcaaatgcaaacgaaaaaaaataaaagc |
37555423 |
T |
 |
| Q |
133 |
aaaacagaaagtaagaagctgattgaagaaacagacatgagattgaacccagaggagtccaaaacttcagttaatttgacatagaaggtttctatctcta |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
37555422 |
aaaacagaaagtaagaagctgattgaagaaacagacatgagattgaacccagaggagtccaaaacttcagttagtttgacatagaaggtctctatctcta |
37555323 |
T |
 |
| Q |
233 |
agtcatcattggacacaacagtaccattggtgagtttggtatctgatggtgatgatgatg |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37555322 |
agtcatcattggacacaacagtaccattggtgagtttggtatctgatggtgatgatgatg |
37555263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University