View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19987_low_2 (Length: 395)
Name: NF19987_low_2
Description: NF19987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19987_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 2e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 19 - 220
Target Start/End: Complemental strand, 41398330 - 41398129
Alignment:
| Q |
19 |
gagaatgagaggtgtttaatgtggtatgaaaattatccatggcatgtgaagattagagatggatggaaggaattcgctgcagcaagcaagtttgtgaaag |
118 |
Q |
| |
|
||||| |||||||||||||| ||||||||| |||||||||||||||||||||||| ||||||||| ||||| || |||||| |||||||||| ||||||| |
|
|
| T |
41398330 |
gagaacgagaggtgtttaatttggtatgaagattatccatggcatgtgaagattaaagatggatgaaaggagtttgctgcaacaagcaagttggtgaaag |
41398231 |
T |
|
| Q |
119 |
gagaccggatcatcttcaacattgttaatattaattttaacaatgagattaaggtgatgaaagaaagttatttatttgaagaggatgctggtgccttttt |
218 |
Q |
| |
|
|||| | ||||||||||||||||||||| || |||| |||||||||||||||||||||||||||||| || || ||||||||||| |||||||||||| |
|
|
| T |
41398230 |
gagaacagatcatcttcaacattgttaacatcaattataacaatgagattaaggtgatgaaagaaagctacacatatgaagaggatgatggtgccttttt |
41398131 |
T |
|
| Q |
219 |
gg |
220 |
Q |
| |
|
|| |
|
|
| T |
41398130 |
gg |
41398129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University