View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19989_low_5 (Length: 273)
Name: NF19989_low_5
Description: NF19989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19989_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 49204175 - 49204039
Alignment:
| Q |
1 |
aaaaaacctaccaactcttgcttcagcaactctttttctttaatgtttgcgcgtctctcctcattcaacttcatcacggcagcctcagtctgcaaagatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49204175 |
aaaaaacctaccaactcttgcttcagcaactctttttctttaatgtttgcgcgtctctcctcattcaacttcatcacggcagcctcagtctgcaaagatc |
49204076 |
T |
 |
| Q |
101 |
aaaactaaagatatgaattgctttcatctttgcactt |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49204075 |
aaaactaaagatatgaattgctttcatctttgcactt |
49204039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 166 - 257
Target Start/End: Complemental strand, 49204019 - 49203928
Alignment:
| Q |
166 |
cacaacttaaagaactgacaccaagtcttggaccatacataagctgagataatatctttataaaccacactggcataggataagcatattac |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49204019 |
cacaacttaaagaactgacaccaagtcttggaccatacataagctgagataatatctttataaaccacactggcataggataagcatattac |
49203928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University