View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1998_high_4 (Length: 343)
Name: NF1998_high_4
Description: NF1998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1998_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 15 - 168
Target Start/End: Original strand, 50883551 - 50883704
Alignment:
| Q |
15 |
aatatacacaaagagtgaggcaccatgataaacaatttgtgtgttagataatacgtaatgagattttagttgtaattgtgttaagagtagttgtgtttat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50883551 |
aatatacacaaagagtgaggcaccatgataaacaatttgtgtgttagataatacgtaatgagattttagttgtaattgtgttaagagtagttgtgtttat |
50883650 |
T |
 |
| Q |
115 |
taatatttcactatttatcagtagagtaaatattttgtattctaaattttgctc |
168 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50883651 |
taatatttcactatttattagtagagtaaatattttgtattctaaattttgctc |
50883704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 230 - 335
Target Start/End: Original strand, 50883766 - 50883871
Alignment:
| Q |
230 |
gagctctctttgttcgtatattgatcctttctctttgattgttttatcttgagttgatcctttttcagttgatttatgtttgatttagttcaattcgatt |
329 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||| ||||||||||||| |
|
|
| T |
50883766 |
gagctctctttatttgtatattgatcctttctctttgattgttttgtcttgagttgatcctttctcggttgatttatgtttgatttggttcaattcgatt |
50883865 |
T |
 |
| Q |
330 |
catctc |
335 |
Q |
| |
|
|||||| |
|
|
| T |
50883866 |
catctc |
50883871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University