View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1998_low_3 (Length: 427)
Name: NF1998_low_3
Description: NF1998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1998_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 28 - 409
Target Start/End: Original strand, 36863923 - 36864300
Alignment:
| Q |
28 |
ccaaccctagtaaatagatttatcacatgactattcttactagtgatgcaacnnnnnnngcagaaaattatgcttgttcaatacaagatcccaaacaccg |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36863923 |
ccaaccctagtaaatagatttatcacatgactattcttactggtgatgcaactttttttgcagaaaattatgcttgttcaatacaagatcccaaacaccg |
36864022 |
T |
 |
| Q |
128 |
ttcacatgtctcaagattgtagcaatctaatatctcgcatttttgttgcaaatccaatgagagtatgtatatgttttgttgctgagtaacatagatatat |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36864023 |
ttcacatgtctcaagattgtagcaatctaatgtctcgcatttttgttgcaaatccaatgagagtatgtatatgttttgttgctgagtaacatagatat-- |
36864120 |
T |
 |
| Q |
228 |
atcttgcattctcgcagtcaacacaatacctttatatcgaaatcagacactaaaaaatacatgtataatttgtatttttagcatccaaaatatcaagttt |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36864121 |
--cttgcattctcgcagtcagcacaatacctttatatcgaaatcagacactaaaaaatacatgtataatttgtatttttagcatccaaaatatcaagttt |
36864218 |
T |
 |
| Q |
328 |
ggcatctagatagatctaatgatcatcgatatgatgacttataactgcgtgaaagcagaaaacacatatcataacatctcct |
409 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36864219 |
gacatctagatagatctaatgatcatcgatatgatgacttatgactgcgtgaaagcagaaaacacatatcataacatctcct |
36864300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University