View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1998_low_9 (Length: 237)
Name: NF1998_low_9
Description: NF1998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1998_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 6924920 - 6925143
Alignment:
| Q |
1 |
agaatttgtaaattggaccataaattttgtactctctaaccttaaattattgcatnnnnnnnctataatagtccctctgttgttagaataatgagtcaac |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6924920 |
agaatttgtaaattggaccttaaattttgtactctctaaccttaaattattgcttaaaaaaactataatagtcactctgttgttagaataatgagtcaac |
6925019 |
T |
 |
| Q |
101 |
gacacaattaacataa---tattgcccaataaaaactctaacatgatcaatcattgtgttcnnnnnnnncttgctatttctacataatttgttttggaaa |
197 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
6925020 |
gacacaattaacataatactattgcccaataaaaactctaacatgatcaatcattgtgttc-tttttttcttgctatttctacataatatgttttggaaa |
6925118 |
T |
 |
| Q |
198 |
ttggcagttttcaatgtttggttct |
222 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
6925119 |
ttggcagttttcaatgtttggttct |
6925143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University