View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19993_high_14 (Length: 331)
Name: NF19993_high_14
Description: NF19993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19993_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 287; Significance: 1e-161; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 5 - 318
Target Start/End: Complemental strand, 6855124 - 6854808
Alignment:
| Q |
5 |
gtaagatattattggacatttcacacatattcaatctaaaatgtcggttatatagcaaataaaacatgcgacggcaaaatatctacttggtttcaacaaa |
104 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6855124 |
gtaagatattattggacacttcacacatattcaatctaaaatgtcggttatatagcaaataaaacatgtgacggcaaaatatctacttggtttcaacaaa |
6855025 |
T |
|
| Q |
105 |
acaggaccactccaaccttcacaattattaattatataatgacacctcactagcactctttattcgatccctttgcaaaagattctctatgtagaat--- |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6855024 |
acaggaccactccaaccttcacaattattaattatataatgacacctcactagcactctttattcgatccctttgcaaaagattctctatgtagaattca |
6854925 |
T |
|
| Q |
202 |
tcacaagtttattttgtttttcattttcataaagaaatgaatgatatggacgtgtcatgctcatctttgttgcttattgaagacagtgcagattctgaag |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6854924 |
tcacaagtttattttgtttttcattttcataaagaaatgaatgatatggatgtatcatgctcatctttgttgcttattgaagacagtgcagattctgaag |
6854825 |
T |
|
| Q |
302 |
gtgaacttattggtttc |
318 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
6854824 |
gtgaacttattggtttc |
6854808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 6861669 - 6861591
Alignment:
| Q |
236 |
aaatgaatgatatggacgtgtcatgctcatctttgttgcttattgaagacagtgcagattctgaaggtgaacttattgg |
314 |
Q |
| |
|
|||||||||||||||| || ||||| |||||| | ||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
6861669 |
aaatgaatgatatggatgtatcatgttcatctctattgcttattgaggacagtgcagattctgaaggtgaccttattgg |
6861591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University