View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19993_high_40 (Length: 218)
Name: NF19993_high_40
Description: NF19993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19993_high_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 79 - 205
Target Start/End: Original strand, 5611820 - 5611946
Alignment:
| Q |
79 |
ggtggtagttgtagtgtgtgttcgttgttaagatgttatggtcactcttgaacactcatatcatctcaaaaactggtgtgcggttattctagtgatggta |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5611820 |
ggtggtagttgtagtgtgtgttcgttgttaagatgttatggtcactgttgaacactcatatcatctcaaaaactggtgtgcggttattctagtgatggta |
5611919 |
T |
|
| Q |
179 |
cgattgtgaacatagctctttgttcat |
205 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
5611920 |
cgattgtgaacatagctctttgttcat |
5611946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University