View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19993_low_26 (Length: 267)
Name: NF19993_low_26
Description: NF19993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19993_low_26 |
 | |
|
| [»] scaffold0753 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 12 - 186
Target Start/End: Original strand, 9464692 - 9464866
Alignment:
| Q |
12 |
atgaaataagacagtgaagaattttatctacagtatctccttttcttttaaaattagaggtatcaccatggctgtcaatccaaacacatcacaccttttt |
111 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9464692 |
atgaaataagagagtgaagaattttatctacagtgtctccttttcttttaaaattagaggtatcaccatggctgtcaatccaaacacatcacatcttttt |
9464791 |
T |
|
| Q |
112 |
tcgaaccccaccaccgataagaatcactttaagagttaatttgaaaagtaagtgatgttgatcttaatatttttc |
186 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9464792 |
tcgaaccccaccactgataagaatcattttaagagttaatttgaaaagtaagtgatgttgatcttaatttttttc |
9464866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 106 - 158
Target Start/End: Original strand, 1905335 - 1905387
Alignment:
| Q |
106 |
cttttttcgaaccccaccaccgataagaatcactttaagagttaatttgaaaa |
158 |
Q |
| |
|
||||||| |||||||||||| |||||||||| ||||| |||||||||||||| |
|
|
| T |
1905335 |
ctttttttcaaccccaccacctataagaatcaatttaatagttaatttgaaaa |
1905387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0753 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0753
Description:
Target: scaffold0753; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 12 - 107
Target Start/End: Original strand, 381 - 476
Alignment:
| Q |
12 |
atgaaataagacagtgaagaattttatctacagtatctccttttcttttaaaattagaggtatcaccatggctgtcaatccaaacacatcacacct |
107 |
Q |
| |
|
|||||||||| ||| |||| ||||||||| || |||||||| ||| |||| || | |||||||||||| || ||||||| ||||||||||||| |
|
|
| T |
381 |
atgaaataaggcagcaaagagttttatctataggatctccttatctcgtaaatttggtggtatcaccatgacttgcaatccagacacatcacacct |
476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University