View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19993_low_30 (Length: 257)
Name: NF19993_low_30
Description: NF19993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19993_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 17 - 189
Target Start/End: Original strand, 9828923 - 9829095
Alignment:
| Q |
17 |
tcgtgctagtccacttgaagatgtgtactcgaactgaccttgcgaagcaacgcgtacaaaacaaatggttctcatcgtaggcttccccgaacacgacata |
116 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9828923 |
tcgtgctagtccacttgaagatgtatactcgaactgaccttgcgaagcaacgcctacaaaacaaatggttctcattgtaggcttccccgaacacgacata |
9829022 |
T |
|
| Q |
117 |
caatgtcatcaactccttctagtggttgcattcaaattactttgcggtataaatttttacattgaccttttgc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9829023 |
caatgtcatcaactccttctagtggttgcattcaaattactttgcggtataaatttttacattgaccttttgc |
9829095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University