View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19993_low_38 (Length: 234)
Name: NF19993_low_38
Description: NF19993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19993_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 26824465 - 26824424
Alignment:
| Q |
181 |
taatttctattttggacagttatttaaatttatgttgtatat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26824465 |
taatttctattttggacagttatttaaatttatgttgtatat |
26824424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 26490795 - 26490836
Alignment:
| Q |
181 |
taatttctattttggacagttatttaaatttatgttgtatat |
222 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26490795 |
taatttctattatggacagttatttaaatttatgttgtatat |
26490836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 41625747 - 41625706
Alignment:
| Q |
181 |
taatttctattttggacagttatttaaatttatgttgtatat |
222 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41625747 |
taatttcttatttggacagttatttaaatttatgttgtatat |
41625706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 29682023 - 29682062
Alignment:
| Q |
183 |
atttctattttggacagttatttaaatttatgttgtatat |
222 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
29682023 |
atttctattttggaaagttatttaaatttttgttgtatat |
29682062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 33468236 - 33468195
Alignment:
| Q |
181 |
taatttctattttggacagttatttaaatttatgttgtatat |
222 |
Q |
| |
|
|||||||||||||||| |||||||| ||||| |||||||||| |
|
|
| T |
33468236 |
taatttctattttggaaagttatttgaatttctgttgtatat |
33468195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University