View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19993_low_40 (Length: 232)
Name: NF19993_low_40
Description: NF19993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19993_low_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 6 - 214
Target Start/End: Complemental strand, 8254893 - 8254685
Alignment:
| Q |
6 |
atgtcgaagaatatgggagcaagagccaagaatgtttatccaaacaaagaaggactgaatggcattattcttcttttaacttttatattttataccattt |
105 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8254893 |
atgtcgattaataggggagcaagagccaagaatgtttatccaaacaaagaaggactgaatggcattattcttcttttaacttttatattttataccattt |
8254794 |
T |
|
| Q |
106 |
tgggtggtggcccctgattcttatgaaaaaggatgtcagattcttccttttcgaaaagaaacactattgtggttctcttttggataatctaaagagcaaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8254793 |
tgggtggtggcccctgattcttatgaaaaaggatgtcagattcttcctttacgaaaagaaacactattgtggttctcttttggataatctaaagagcaaa |
8254694 |
T |
|
| Q |
206 |
atgggaaga |
214 |
Q |
| |
|
|| |||||| |
|
|
| T |
8254693 |
attggaaga |
8254685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University