View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19993_low_41 (Length: 232)
Name: NF19993_low_41
Description: NF19993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19993_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 20 - 218
Target Start/End: Original strand, 1263987 - 1264185
Alignment:
| Q |
20 |
gcagatggtttaatgcaaacgccttttgcatcagaatcaatactcccatcagaactgccttcatctacaacgaaaccacaaacggttcatctacacgcca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1263987 |
gcagatggtttaatgcaaacgccttttgcatcagaatcaatactcccatcagaactgccttcatctacaacgaaaccacaaactgttcatctacacgcca |
1264086 |
T |
 |
| Q |
120 |
atatcatagacgagaactcgagtaactctcaggtaattcttattgtaatattatttttaaaatgctcatattgttttgctatattatatttgaacccat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1264087 |
atatcatagacgagaactcgagtaactctcaagtaattcttattgtaatattatttttaaaatgctcatattgttttgctatattatatttgaacccat |
1264185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University