View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19996_low_17 (Length: 300)
Name: NF19996_low_17
Description: NF19996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19996_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 29 - 266
Target Start/End: Complemental strand, 34018711 - 34018474
Alignment:
| Q |
29 |
gatgaatgggtatgtaaaatgtttaggggttagtttgtgctctttagcgttttcagttaaatatatgttttattacttgagccctaaattgtctccaaat |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34018711 |
gatgaatgggtatgtaaaatgtttaggggttagtttgtgctctttagcgttttcagttaaatatatgttttattacttgagccctaaattgtctccaaat |
34018612 |
T |
|
| Q |
129 |
gtttatagaaagaaagaagggaaaagtacctggctcggcagcaagttcaagcagtagatacagtgtaaagcacaatttgtttttcttgctagtgtttttc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34018611 |
gtttatagaaagaaagaagggaaaagtacctggctcggcagcaagttcaagcagtagatacagtgtaaagcacaatttgtttttcttgctagtgtttttc |
34018512 |
T |
|
| Q |
229 |
ttcagagaatgataaatcaagatgttattggtgatgat |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34018511 |
ttcagagaatgataaatcaagatgttattggtgttgat |
34018474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University