View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19996_low_19 (Length: 297)
Name: NF19996_low_19
Description: NF19996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19996_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 32146301 - 32146147
Alignment:
| Q |
1 |
tgataagttataaacaacaaaaactttaggatacaatgtgaactatcattaaaattgtcttctggcataaacaaatagcatacaatataata---ataac |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32146301 |
tgataagttataaacaacaaaaactttaggatacaatgtaaactatcattaaaattgtcttctggcataaacaaatagcatacaatataataataataac |
32146202 |
T |
 |
| Q |
98 |
aatcttgtttaagaccaaaatcaataatatgcaaaataatgccaaaattaagata |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32146201 |
aatcttgtttaagaccaaaatcaataatatgcaaaataatgccaaaattaagata |
32146147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 169 - 279
Target Start/End: Complemental strand, 32145035 - 32144926
Alignment:
| Q |
169 |
aagttcaattttaactttcaaattgatagtgaatgaatacttgactagtttgtttaaaaattgttacgatgaaatttagtttttaacatgacatgaaacg |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32145035 |
aagttcaattttaactttcaaattgatagtgaatgaatacttgactagtttgtttaaaaattgttacgatgaaatttag-ttttaacatgacatgaaacg |
32144937 |
T |
 |
| Q |
269 |
agggcaaaatt |
279 |
Q |
| |
|
||||||||||| |
|
|
| T |
32144936 |
agggcaaaatt |
32144926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University