View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19996_low_29 (Length: 243)
Name: NF19996_low_29
Description: NF19996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19996_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 10 - 225
Target Start/End: Original strand, 31805869 - 31806084
Alignment:
| Q |
10 |
attattctatccattcgttagtggctgctctttcttcttatggactcaagttaacactatgannnnnnngttgttgatgttacatcaattaagacacatg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
31805869 |
attattctatccattcgttagtggctgctctttcttcttatggactcaagttaacactatgatttttttgttgttgatgttacatcaattaatacacatg |
31805968 |
T |
|
| Q |
110 |
catccatttatagcatatatgaattgctgcattgcctttattccttccctattatgtagagtaaatgaactgctacatctatgcattgatgctcatatgt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31805969 |
catccatttatagcatatatgaattgctgcattgcctttattccttccctattatgtagagtaaatgaactgctacatctatgcattgatgctcatatat |
31806068 |
T |
|
| Q |
210 |
attgtttagtaggtat |
225 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
31806069 |
attgtttagtaggtat |
31806084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University