View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19996_low_31 (Length: 239)

Name: NF19996_low_31
Description: NF19996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19996_low_31
NF19996_low_31
[»] chr3 (1 HSPs)
chr3 (16-220)||(55396186-55396390)


Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 220
Target Start/End: Original strand, 55396186 - 55396390
Alignment:
16 gaatatgaatgttacattagcagcagcagcaggaggaggatttatctctttcaaacaactacatctacgtcgtcgtcttcttctttccttctgtacatca 115  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
55396186 gaatatgaatgttacattagcagcagcagcagcaggaggatttatctctttcaaacaactacatctacgtcgtcgtcttcttcttcccttctgtacatca 55396285  T
116 tcgtcgttgtcatcaccgaactcgcaagacaatgatagtaattgtgtgagtggagattccatacgggaaagatttcttagtttttatgcttcccgtggtc 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55396286 tcgtcgttgtcatcaccgaactcgcaagacaatgatagtaattgtgtgagtggagattccatacgggaaagatttcttagtttttatgcttcccgtggtc 55396385  T
216 acaag 220  Q
    |||||    
55396386 acaag 55396390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University