View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19996_low_31 (Length: 239)
Name: NF19996_low_31
Description: NF19996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19996_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 220
Target Start/End: Original strand, 55396186 - 55396390
Alignment:
| Q |
16 |
gaatatgaatgttacattagcagcagcagcaggaggaggatttatctctttcaaacaactacatctacgtcgtcgtcttcttctttccttctgtacatca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
55396186 |
gaatatgaatgttacattagcagcagcagcagcaggaggatttatctctttcaaacaactacatctacgtcgtcgtcttcttcttcccttctgtacatca |
55396285 |
T |
 |
| Q |
116 |
tcgtcgttgtcatcaccgaactcgcaagacaatgatagtaattgtgtgagtggagattccatacgggaaagatttcttagtttttatgcttcccgtggtc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55396286 |
tcgtcgttgtcatcaccgaactcgcaagacaatgatagtaattgtgtgagtggagattccatacgggaaagatttcttagtttttatgcttcccgtggtc |
55396385 |
T |
 |
| Q |
216 |
acaag |
220 |
Q |
| |
|
||||| |
|
|
| T |
55396386 |
acaag |
55396390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University