View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19996_low_32 (Length: 225)
Name: NF19996_low_32
Description: NF19996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19996_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 56 - 206
Target Start/End: Complemental strand, 6693994 - 6693843
Alignment:
| Q |
56 |
ttcttttcacaattgacttgataaaatgcgtttttaaacattcactcctttcacgtcatcacagacagtgtgagtgaag-gttcatttgtttgttattga |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
6693994 |
ttcttttcacaattgacttgataaaatgcgtttttaaacattcactcctttcacgtcatcacagacggtgtgagtgaagtattcatttgtttgttattga |
6693895 |
T |
|
| Q |
155 |
tggcattaggaggaattatccatttcaacactctcttcatgcaccaaccact |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6693894 |
tggcattaggaggaattatccatttcaacactctcttcatgcaccaaccact |
6693843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University