View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19997_low_6 (Length: 423)
Name: NF19997_low_6
Description: NF19997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19997_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 3e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 19 - 204
Target Start/End: Original strand, 7275394 - 7275579
Alignment:
| Q |
19 |
gtaccagttcaatatggtcattgcatttcaaactcaaaacgtaactaatcaaattaattaatgcaatattatattcaaagaccctaccacacaagcaacc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7275394 |
gtaccagttcaatatggtcattgcatttcaaactcaaaacgtaactaatcaaattaattaatgcaatattatattcaaagaccctaccacacaagcaacc |
7275493 |
T |
 |
| Q |
119 |
ctttgtctatataaacacatatttgcctcacatatttcctccccctcttcttcctcttgcttctttcaatatcttagcattgcttt |
204 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7275494 |
ctttgtctatttaaacacatatttgcctcacatatttcctccccctcttcttcctcttgcttctttcaatatcttagcattgcttt |
7275579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 303 - 408
Target Start/End: Original strand, 7275703 - 7275808
Alignment:
| Q |
303 |
ctctagttaaaactttagtcattatacccttaaaccttcaccttttaattttcaatcaaccatagcttcaaaaccattgaaaaaacataattgacattaa |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7275703 |
ctctagttaaaactttagtcattatacccttaaaccttcaccttttaattttcaatcaaccatagcttcaaaaccattgaaaaaacataattgacattaa |
7275802 |
T |
 |
| Q |
403 |
cctatg |
408 |
Q |
| |
|
|||||| |
|
|
| T |
7275803 |
cctatg |
7275808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University