View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19998_low_12 (Length: 204)
Name: NF19998_low_12
Description: NF19998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19998_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 17 - 190
Target Start/End: Complemental strand, 22621678 - 22621505
Alignment:
| Q |
17 |
tcaaccaagtaaaactttacacccttctgaaattcatggatacgaggataattcttctaaaatttggctctttcgataagaagcaattctactaactctg |
116 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
22621678 |
tcaaccatgtaaaaatttacacccttctgaaattcttggatacgaggatcattcttctaaaatttggctctttcgataagaagcaattctactaaccatg |
22621579 |
T |
 |
| Q |
117 |
actctcataactcgtagaaatcttgcattcttcaaaatgtatcttgcaaattgaatatcacctttccaaccttc |
190 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22621578 |
actctcataacctgtagaaatcttgcattcttcaaaatgtatcttgaaaattgaatatcacctttccaaccttc |
22621505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 17 - 190
Target Start/End: Original strand, 15147400 - 15147573
Alignment:
| Q |
17 |
tcaaccaagtaaaactttacacccttctgaaattcatggatacgaggataattcttctaaaatttggctctttcgataagaagcaattctactaactctg |
116 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||| | ||||||||||||||| ||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
15147400 |
tcaaccaagtaaaaatttacacccttctgaaattcttggatgcaaggataattcttctataatttggctctttcgataagaggcaattctaataactctg |
15147499 |
T |
 |
| Q |
117 |
actctcataactcgtagaaatcttgcattcttcaaaatgtatcttgcaaattgaatatcacctttccaaccttc |
190 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
15147500 |
actctcataacctgtagaaacctcgcattcttcaaaatgtatcttaaaaattgaatatcacctttccaaccttc |
15147573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 26 - 183
Target Start/End: Complemental strand, 8794296 - 8794142
Alignment:
| Q |
26 |
taaaactttacacccttctgaaattcatggatacgaggataattcttctaaaatttggctctttcgataagaagcaattctactaactctgactctcata |
125 |
Q |
| |
|
||||| |||||| ||||| ||| ||| |||| |||||||||| ||||||| ||| | ||||||||||||||| | | || ||||||| || | |||| |
|
|
| T |
8794296 |
taaaagtttacatccttcagaacttcttggacacgaggataaatcttctataatcttgctctttcgataagaggga---ctgctaactccgagtttcatg |
8794200 |
T |
 |
| Q |
126 |
actcgtagaaatcttgcattcttcaaaatgtatcttgcaaattgaatatcacctttcc |
183 |
Q |
| |
|
|| |||||||||||||||||| |||||| |||||||||||||||| |||||| |||| |
|
|
| T |
8794199 |
acctgtagaaatcttgcattctgcaaaatatatcttgcaaattgaagatcaccattcc |
8794142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University