View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19999_high_2 (Length: 391)
Name: NF19999_high_2
Description: NF19999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19999_high_2 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 167 - 391
Target Start/End: Complemental strand, 52926025 - 52925801
Alignment:
| Q |
167 |
ggagtttatgggaaaggttttaggtttaagattgagtcaaatgactcttcagagaggatggaataacaagtcaaagcttcttgtggtcagtcatgtcttc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926025 |
ggagtttatgggaaaggttttaggtttaagattgagtcaaatgactcttcagagaggatggaataacaagtcaaagcttcttgtggtcagtcatgtcttc |
52925926 |
T |
|
| Q |
267 |
ttcaacttaaccaagtagtaagtatttctcaacaaacatatatactaacgctaattttcaccatcatttcaggtggaggatctcactgctagacaagttt |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52925925 |
ttcaacttaaccaagtagtaagtatttctcaacaaacatatatactaatgctaattttcaccatcatttcaggtggaggatctcactgctagacaagttt |
52925826 |
T |
|
| Q |
367 |
atgagaaacttttggaggctgtgca |
391 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
52925825 |
atgagaaacttttggaggctgtgca |
52925801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 14 - 155
Target Start/End: Complemental strand, 52926221 - 52926080
Alignment:
| Q |
14 |
ctgttgctgctgaaaccaacccacaggatgctcccgttccaccctgcatttccactcttgaaggtggtcttgttcaacttgctattgaagttgaggatcg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52926221 |
ctgttgctgctgaaaccaacccacaggatgctcccgttccaccctgcatttccactcttgaaggtggtcttgttcaacttgctattgaagttgaagatcg |
52926122 |
T |
|
| Q |
114 |
tgctcaccgctccgcaatcaccagagtaaatgctgatgatgt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926121 |
tgctcaccgctccgcaatcaccagagtaaatgctgatgatgt |
52926080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University