View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19999_low_2 (Length: 246)
Name: NF19999_low_2
Description: NF19999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19999_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 30964893 - 30964648
Alignment:
| Q |
1 |
caataaacctcaataactaagtcttcatgtttgccttaatttgagctggataagcaaggaaacacacagctttgttttattctcttgacattgcatttaa |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30964893 |
caataaacctcaataactaagtattcatgtttgccttaatttgagctggataagcaaggaaacacacagctttgttttattctcttgacattgcatttaa |
30964794 |
T |
 |
| Q |
101 |
cacaaacatgcttcttcttgaggttgaattagttcaatcc-nnnnnnnggacgagcatgtcctttgaagtgtgaatatgtttttctatttaaatttccca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30964793 |
cacaaacatgcttcttcttgaggttgaattagttcaatcctttttttgggacgggcatgtcctttgaagtgtgaatatgtttttctatttaaatttccca |
30964694 |
T |
 |
| Q |
200 |
tcaggtaatattgtttgcttgcagaagatgaggatgatgatgatgt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30964693 |
tcaggtaatattgtttgcttgcagaagatgaggatgatgatgatgt |
30964648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 3 - 48
Target Start/End: Complemental strand, 30964939 - 30964894
Alignment:
| Q |
3 |
ataaacctcaataactaagtcttcatgtttgccttaatttgagctg |
48 |
Q |
| |
|
||||||||||| || |||| ||||||||||||||||||||||||| |
|
|
| T |
30964939 |
ataaacctcaacaatcaagtattcatgtttgccttaatttgagctg |
30964894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University