View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1999_high_38 (Length: 311)
Name: NF1999_high_38
Description: NF1999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1999_high_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 19 - 296
Target Start/End: Original strand, 47604083 - 47604365
Alignment:
| Q |
19 |
agaagaccagatagaaatttgactttcct---ttatg----gtcatggatttgcatccatgtgtcccaagtccctctcaatccctttcaaactaaattaa |
111 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47604083 |
agaagaccaaatagaaatttgactttcctgctttatgcatggtcatggatttgcatccatgtgtcccaagtccctctcaatccctttcaaactaaattaa |
47604182 |
T |
|
| Q |
112 |
ctaacaaatttgcaataaacaataacaaaatacaaacggcaaagcaacattatgtgttattggtagctagctactgcctacatccatccatggcttccaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47604183 |
ctaacaaatttgcaataaacaataacaaaatacaaacggcaaagcaacattatgt--tattggtagccagctactgcctacatccatccatggcttccaa |
47604280 |
T |
|
| Q |
212 |
tatcaaagtactagtcttcttcttaaccatttcaatcatcttcctcaattttgcaataaattctcatgcacaagacccaaatttt |
296 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47604281 |
tatcaaagtgttagtcttcttcttaaccatttcaatcatcttcctcaattttgcaataaattctcatgcacaagacccaaatttt |
47604365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University