View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1999_high_43 (Length: 297)
Name: NF1999_high_43
Description: NF1999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1999_high_43 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 215 - 282
Target Start/End: Complemental strand, 31615940 - 31615873
Alignment:
| Q |
215 |
tgtacctcgatattcagggactaggagcaattttggtgccatatgtctcattctagcataaatctctg |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31615940 |
tgtacctcgatattcagggactaggagcaattttggtgccatatgtctcattctagcataaatctctg |
31615873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 19 - 120
Target Start/End: Complemental strand, 31616099 - 31616002
Alignment:
| Q |
19 |
tgatcatcatctgattctttaattaattaaattaacacaaacaagaaaataaataaatatagtcaaattaatatca-cagcaagtaaattttgtatgaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| ||| |||||||||||||||||| |
|
|
| T |
31616099 |
tgatcatcatctgattctttaattaattaa-----cacaaacaagaaaataaataaatatagtcaaattaaggtcagcagggagtaaattttgtatgaat |
31616005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University