View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1999_high_54 (Length: 253)
Name: NF1999_high_54
Description: NF1999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1999_high_54 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 142 - 253
Target Start/End: Complemental strand, 25109703 - 25109592
Alignment:
| Q |
142 |
aggtaaagatgctttgcatagtaaatcaataaatatgattcataattttttagtgcaaagtttaacac-gaataacaatgctttttcagagcctctcaga |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||||||||||| || |
|
|
| T |
25109703 |
aggtaaagatgctttgcatagtaaatcaataaatatgattcataattttttagtgtaaagtttaacacaaaataacaatgc-ttttcagagcctctcgga |
25109605 |
T |
 |
| Q |
241 |
tcatatccgcctt |
253 |
Q |
| |
|
||||||||||||| |
|
|
| T |
25109604 |
tcatatccgcctt |
25109592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 9 - 73
Target Start/End: Complemental strand, 25109838 - 25109774
Alignment:
| Q |
9 |
gaagaatataaagaaaatatgaggaagattgctaactacctaaaggtaaataatgtttttccaca |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25109838 |
gaagaatataaagaaaatatgaggaagattgctaactacctaaaggtaaataatgtttttccaca |
25109774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University