View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1999_high_61 (Length: 244)
Name: NF1999_high_61
Description: NF1999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1999_high_61 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 40970106 - 40969980
Alignment:
| Q |
1 |
agagaatgatagagaagacgaaagatagaaggtgactgagttgggaaacgagttagaacgttgtgactcgttatttgatatttggccattggatctgacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40970106 |
agagaatgatagagaagacgaaagatagaaggtgactgagttgggaaacgagttagaacgttgtgactcgttatttgatatttggccattggatctgacg |
40970007 |
T |
|
| Q |
101 |
cgtaggattgtattaaccgttgatgta |
127 |
Q |
| |
|
||| |||||| |||||||||||||||| |
|
|
| T |
40970006 |
cgttggattgcattaaccgttgatgta |
40969980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 236
Target Start/End: Complemental strand, 40969930 - 40969871
Alignment:
| Q |
177 |
gtggagtttataaataggtgaaacaaagtgggaagattactaggaatttgttgtatgtcg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40969930 |
gtggagtttataaataggtgaaacaaagtgggaagattactaggaatttgttgtatgtcg |
40969871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University