View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1999_high_66 (Length: 239)
Name: NF1999_high_66
Description: NF1999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1999_high_66 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 28439171 - 28439398
Alignment:
| Q |
1 |
ctgctagacttcaatgtcacaccattgataattttgtttatatgtgtaatttaattttgttatttataaacagaagaatcagaacacatagcgtgttcct |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28439171 |
ctgctagacttcaatgtcacacctttgataattttgtttatatgtgtaatttaattttgttatttataaacagaagaatcagaacacatagcgtgttcct |
28439270 |
T |
|
| Q |
101 |
ctttatgtatcagagaactgagtgatcttcagatttatactgattgatcaatgtaatgaacaaaacacagcacagtgtaccaatgtagcagtgactgatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28439271 |
ctttatgtatcagagaactgagtgatcttcagatatatactgattgatcaatgtaatgaacaaaacacagcacagtgtaccaatgtagcagtgaccgatc |
28439370 |
T |
|
| Q |
201 |
aaagcctgtaacattgctctttctctct |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
28439371 |
aaagcctgtaacattgctctttctctct |
28439398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University