View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1999_high_7 (Length: 532)
Name: NF1999_high_7
Description: NF1999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1999_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 352; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 156 - 515
Target Start/End: Complemental strand, 48392867 - 48392508
Alignment:
| Q |
156 |
gtcatcaaccgacgaagatcggagtttagaagaaattaccagaggaagaatatcggcgggagcagatcggagtttagagggaagatcagggtcaaaagag |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48392867 |
gtcatcaaccgacgaagatcggagtttagaagaaattaccagaggaagaatatcggcgggagcagatcggagtttagagggaagatcagggtcaaaagag |
48392768 |
T |
 |
| Q |
256 |
tcaagatcttccatatcaacgagaagatatttgggattatggagaagactttctctgtaagggaagacattgttaccggtttcgaagttacggatgaatt |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48392767 |
tcaagatcttccatatcaacgagaagatatttgggattatggaggagactttctctgtaagggaagacattgttaccggtttcgaagttacggatgaatt |
48392668 |
T |
 |
| Q |
356 |
ctttgaatttttgaagaatggtgtggttggagatggtggcgtcggtttcgccgccgcggccgtcgtcccatgagtgtgcttggtcgctatagtatacgcc |
455 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48392667 |
ctttgaatttttgaagaatggtgtggttggagatggcggcgtcggtttcgccgccgcggccgtcgtcccatgagtgtgcttggtcgctatagtatacgcc |
48392568 |
T |
 |
| Q |
456 |
tccttcgtcccaacctgacattgtttagatctctgatttgggattagggtttcggtgttt |
515 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48392567 |
tccttcgtcccaacctgacattgtttagatctctgatttgggattagggtttcggtgttt |
48392508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 9 - 96
Target Start/End: Complemental strand, 48393014 - 48392927
Alignment:
| Q |
9 |
acatcatcaggagcagcatcttccatatcaccagtatctccagcaaccttcgtcttcaaactcaccaaaacctgcgccgccgcagttt |
96 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48393014 |
acatcaccaggagcagcatcttccatatcaccagtatctccagcaaccttcgtcttcaaactcaccaaaacctgcgccgccgcagttt |
48392927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University