View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1999_high_70 (Length: 224)
Name: NF1999_high_70
Description: NF1999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1999_high_70 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 84 - 209
Target Start/End: Complemental strand, 34023509 - 34023384
Alignment:
| Q |
84 |
tgagagtgcaatgctttcaataacaaacaacttaaccaaacatttaaactaaaaaggtgaaaccctaactctaannnnnnnggatagttttttgtcaaca |
183 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34023509 |
tgagagtgcaatactttcaataacaaacaacttaaccaaacatttaaactaaaaaggtgaaaccctaactctaatttttttggatagttttttgtcaaca |
34023410 |
T |
 |
| Q |
184 |
actttaaagcatatgaatattatttt |
209 |
Q |
| |
|
|||||||||| ||||||||||||||| |
|
|
| T |
34023409 |
actttaaagcttatgaatattatttt |
34023384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 24 - 85
Target Start/End: Complemental strand, 34023722 - 34023661
Alignment:
| Q |
24 |
agtgttaactcctaaattcgtttgagcttacgttttaaggtgtgaatttagtgacaaacttg |
85 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34023722 |
agtgttaactcctaaattcgcttgagcttacgttttaaggtgtgaatttagtgacaaacttg |
34023661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University