View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1999_high_73 (Length: 215)
Name: NF1999_high_73
Description: NF1999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1999_high_73 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 13 - 199
Target Start/End: Complemental strand, 15761947 - 15761761
Alignment:
| Q |
13 |
ttctgctattgttgtttattgccttgtctcaacattgaacagaatatctttggtctatgagtaggatttatagatctttacttcaaccctgtaattttct |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15761947 |
ttctgctattgttgtttattgccttgtctcaacattgaacaaaatatctttggtctatgagtaggatttatagatctttacttcaaccctgtaattttct |
15761848 |
T |
|
| Q |
113 |
tccatttaaaataacaaattgaaatagtagatatagaagccgtgcaaattatgctttgtttgttacgattgggtgggaggttgtttt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15761847 |
tccatttaaaataacaaattgaaatagtagatatagaagccgtgcaaattatgctttgtttgttacggttgggtgggaggttgtttt |
15761761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 50 - 145
Target Start/End: Complemental strand, 13330941 - 13330846
Alignment:
| Q |
50 |
aacagaatatctttggtctatgagtaggatttatagatctttacttcaaccctgtaattttcttccatttaaaataacaaattgaaatagtagata |
145 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||| || |||||||| |||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
13330941 |
aacaaaatatctttggcctatgagtaggatttatagatctttcctgcaaccctgcaatttttttccatttaaaataacaaattgaaatagaagata |
13330846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 50 - 145
Target Start/End: Complemental strand, 13341856 - 13341761
Alignment:
| Q |
50 |
aacagaatatctttggtctatgagtaggatttatagatctttacttcaaccctgtaattttcttccatttaaaataacaaattgaaatagtagata |
145 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||| || |||||||| |||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
13341856 |
aacaaaatatctttggcctatgagtaggatttatagatctttcctgcaaccctgcaatttttttccatttaaaataacaaattgaaatagaagata |
13341761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 50 - 145
Target Start/End: Complemental strand, 5671388 - 5671293
Alignment:
| Q |
50 |
aacagaatatctttggtctatgagtaggatttatagatctttacttcaaccctgtaattttcttccatttaaaataacaaattgaaatagtagata |
145 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||| || |||||||| |||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
5671388 |
aacaaaatatctttggcctatgagtaggatttatagatctttcctgcaaccctgcaatttttttccatttaaaataacaaattgaaatagaagata |
5671293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 91
Target Start/End: Complemental strand, 13755951 - 13755907
Alignment:
| Q |
47 |
ttgaacagaatatctttggtctatgagtaggatttatagatcttt |
91 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13755951 |
ttgaacataatatctttggtctatgagtgagatttatagatcttt |
13755907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University