View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1999_low_31 (Length: 362)
Name: NF1999_low_31
Description: NF1999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1999_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 288
Target Start/End: Original strand, 5956989 - 5957250
Alignment:
| Q |
18 |
gataattcataagatttctagtgaagtaacaacatagttcaacgtcaaattacatgcatcatttattacaaatatggagggatatctaaataatccaact |
117 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
5956989 |
gataattcataacatttctagtgaagtaacaacatagttcaacgtcaaattacatgcatcatttattacaaatatggagggatatttaaataatctaact |
5957088 |
T |
|
| Q |
118 |
catcggttgcaaattacaaatgaaatgaaaagtagatgcatcatcatatatatcatgaatttcaatggacactaagcactcactgacatttttaacaagt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5957089 |
catcggttgcaaattacaaatgaaatgaaaagtagatgcatcatc----atatcatgaatttcaatggacactaagcactcactgacatttttaacaagt |
5957184 |
T |
|
| Q |
218 |
cttttgtgaatttaattagatttagtcgtaaactcttcttctgccttagaatttagaagcaaaacaccaac |
288 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
5957185 |
cttttgtgaat----ttagatttagtcgtaaactcttcttctgcctcag-atttagaagcaaaacaccaac |
5957250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 67 - 126
Target Start/End: Original strand, 5950734 - 5950792
Alignment:
| Q |
67 |
ttacatgcatcatttattacaaatatggagggatatctaaataatccaactcatcggttg |
126 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||| ||||||||||||||||||||||||| |
|
|
| T |
5950734 |
ttacatgcatcatttattgcaattc-ggagggatttctaaataatccaactcatcggttg |
5950792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University