View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1999_low_41 (Length: 307)
Name: NF1999_low_41
Description: NF1999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1999_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 13 - 204
Target Start/End: Original strand, 4891515 - 4891701
Alignment:
| Q |
13 |
agatgaagaacttgccatctcgcagaatcaaaaaccctagcgagatggaccgagagcacgcaaaattgaaaacctaatcaattatcctggttatggatac |
112 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4891515 |
agatgaagaacttgccatctcgcggaatcaaaaaccctagcgagatggaccga-----cgcaaaattgaaaacctaatcaattatcctggttatggatac |
4891609 |
T |
|
| Q |
113 |
agctgtcagaaatggattgttctctttgtctggatcgggaatgaatgaatgctttgttgcaattgcaatttcatatacacaaaaagggaaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4891610 |
agctgtcagaaatggattgttctctttgtctggatcgggaatgaatgaatgctttgttgcaattgcaatttcatatacacaaaaagggaaaa |
4891701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 237 - 291
Target Start/End: Original strand, 4891738 - 4891792
Alignment:
| Q |
237 |
ttaatattttacggtgtgagtgaaaccactaacaaaacaacgatgtggatggaag |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4891738 |
ttaatattttacggtgtgagtgaaaccactaacaaaacaacgatgtggatggaag |
4891792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 111 - 204
Target Start/End: Complemental strand, 440137 - 440042
Alignment:
| Q |
111 |
acagctgtcagaaatggattgttctctttgtctggatcgggaatgaatgaatgctttgttgcaattgcaatttcatatacac--aaaaagggaaaa |
204 |
Q |
| |
|
||||||||||||| ||| ||||||||||| |||||||||||||||||| |||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
440137 |
acagctgtcagaattggtttgttctctttctctggatcgggaatgaatcaatgttttgttgcaattgcaatttcatatacacagaaaaagggaaaa |
440042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 13 - 67
Target Start/End: Complemental strand, 440237 - 440183
Alignment:
| Q |
13 |
agatgaagaacttgccatctcgcagaatcaaaaaccctagcgagatggaccgaga |
67 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
440237 |
agatgaagaactcgccatctcgcggaatcaaaaaccctagcgagatggatcgaga |
440183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 242 - 291
Target Start/End: Complemental strand, 440026 - 439977
Alignment:
| Q |
242 |
attttacggtgtgagtgaaaccactaacaaaacaacgatgtggatggaag |
291 |
Q |
| |
|
||||||| |||||||||| | |||||||||||||||||||||||| |||| |
|
|
| T |
440026 |
attttacagtgtgagtgagatcactaacaaaacaacgatgtggatagaag |
439977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University