View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1999_low_44 (Length: 300)
Name: NF1999_low_44
Description: NF1999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1999_low_44 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 290
Target Start/End: Complemental strand, 31826682 - 31826402
Alignment:
| Q |
18 |
gatatattaaggaacaaggtaaactacaaa-------tctttttaag-ccctagcaaagcttgagataaatgactatccacggtagggttttagatcttg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31826682 |
gatatattaaggaacaaggtaaactacaaactacaaatctttttaaggccctagcaaagcttgagataaatgactatccacggtagggttttagatcttg |
31826583 |
T |
|
| Q |
110 |
aaagaagaatattgttgctattattttatctaaaatgaattttaaacgatcattcgaaggttacaatttacaactttatcaactggcgaaataatataca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31826582 |
aaagaagaatattgttgctattattttatctaaaatgaattttaaacgatcattcgaaggttacaatttacaactttatcaactggcgaaataatataca |
31826483 |
T |
|
| Q |
210 |
atattagagtagagtttaacatatgaactagttatttgatgtcaaaacaattattacaatttacaactttatcaacctatg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31826482 |
atattagagtagagtttaacatatgaactagttatttgatgttaaaacaattattacaatttacaactttatcaacctatg |
31826402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University