View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1999_low_45 (Length: 297)

Name: NF1999_low_45
Description: NF1999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1999_low_45
NF1999_low_45
[»] chr6 (2 HSPs)
chr6 (215-282)||(31615873-31615940)
chr6 (19-120)||(31616002-31616099)


Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 215 - 282
Target Start/End: Complemental strand, 31615940 - 31615873
Alignment:
215 tgtacctcgatattcagggactaggagcaattttggtgccatatgtctcattctagcataaatctctg 282  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31615940 tgtacctcgatattcagggactaggagcaattttggtgccatatgtctcattctagcataaatctctg 31615873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 19 - 120
Target Start/End: Complemental strand, 31616099 - 31616002
Alignment:
19 tgatcatcatctgattctttaattaattaaattaacacaaacaagaaaataaataaatatagtcaaattaatatca-cagcaagtaaattttgtatgaat 117  Q
    ||||||||||||||||||||||||||||||     ||||||||||||||||||||||||||||||||||||  ||| |||  ||||||||||||||||||    
31616099 tgatcatcatctgattctttaattaattaa-----cacaaacaagaaaataaataaatatagtcaaattaaggtcagcagggagtaaattttgtatgaat 31616005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University