View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1999_low_47 (Length: 284)
Name: NF1999_low_47
Description: NF1999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1999_low_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 811463 - 811193
Alignment:
| Q |
1 |
cattattacaagcttcttctcagttatgttttgttcttcattttcatgatggcaaagaaggtgaatgtgattccactagtatcgaccagaggacttgcac |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
811463 |
cattattacaagcctcttctcagttatgttttgttcttcattttcatgatggcaaaggaggtgaatgtgattccactagtatcgaccagaggacttgcac |
811364 |
T |
|
| Q |
101 |
atcttcataggggcaagatttgacatcttcatacagaatgtatatccctcttcctgcaac--nnnnnnnnnttggtatgattagtgtataaatttgcata |
198 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| ||||||||||||||||||| |
|
|
| T |
811363 |
atcttcgtaggggcaagatttgacatcttcatacagaatgtatatccctcttcctgcaacaacaaaaaaaattggcatgagtagtgtataaatttgcata |
811264 |
T |
|
| Q |
199 |
atgttacttctgtatctatgaaatttcattgaagtgaaggtgaaggatggaactgtatagtttgtgattga |
269 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
811263 |
atgttacttctgtttctatgaaatttcattgaagtgaaggtgaaggatggaactgtatagtttgtgattga |
811193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 49 - 156
Target Start/End: Original strand, 47067034 - 47067141
Alignment:
| Q |
49 |
atggcaaagaaggtgaatgtgattccactagtatcgaccagaggacttgcacatcttcataggggcaagatttgacatcttcatacagaatgtatatccc |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| | ||| |
|
|
| T |
47067034 |
atggcaaagaaggtgaatgtgattccactagtatggaccagaggacgtgcacatcttcataggggcaagatttgacatcttcatatagaatgtaaagccc |
47067133 |
T |
|
| Q |
149 |
tcttcctg |
156 |
Q |
| |
|
|||||||| |
|
|
| T |
47067134 |
tcttcctg |
47067141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University