View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1999_low_49 (Length: 281)
Name: NF1999_low_49
Description: NF1999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1999_low_49 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 13 - 281
Target Start/End: Original strand, 44974766 - 44975034
Alignment:
| Q |
13 |
aatattggaagaactaaaggtaaaagcagagagatcagatacaagagttcaaggattcatgaaatttgtacactttttagaaggttttggaagatcatat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44974766 |
aatattggaagaactaaaggtaaaagcagagagatcagatacaagagttcaaggattcatgaaatttgtacactttttagaagattttggaagatcatat |
44974865 |
T |
|
| Q |
113 |
accgaacaaaacaactactgttgacaaacacagcagaagcattacttgttggtcttgttttaggaacaatttacataaacattgggtttgataaagaagg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44974866 |
accgaacaaaacaactactgttgacaaacacagcagaagcattacttgttggtcttgttttaggaacaatttacataaacattgggtttgataaagaagg |
44974965 |
T |
|
| Q |
213 |
gattgagaaaaggtttggtctttttgcattcactctaacattcctcttatcttccacaactgaaacact |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44974966 |
gattgagaaaaggtttggtctttttgcattcactctaacattcctcttatcttccacaactgaaacact |
44975034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University