View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1999_low_59 (Length: 250)
Name: NF1999_low_59
Description: NF1999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1999_low_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 25 - 237
Target Start/End: Original strand, 52618317 - 52618529
Alignment:
| Q |
25 |
atagatcaggggtctagttacatccggtctggttcggcgattttgtagaaactaaatgaatgcgacgtcgtttttagagaaccagaacctctgacacttg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52618317 |
atagatcaggggtctagttacatccggtctggttgggcgattttgtagaaactaaatgaatgcgacgtcgtttttagagaaccagaacctctgacacttg |
52618416 |
T |
 |
| Q |
125 |
ccctaaccccctgattcacaaccgcatactcgccggagcaccaccctcaacgttgcgtcgttcacgcaaactcgccgggaaagtcaccatcatcaaatcc |
224 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52618417 |
ccctaaccccctgattcacaaccacatactcgccggagcaccaccctcaacgttgagtcgttcacgcaaactcgccgggaaagtcaccgtcatcaaatcc |
52618516 |
T |
 |
| Q |
225 |
tccttgtaagttc |
237 |
Q |
| |
|
||||||||||||| |
|
|
| T |
52618517 |
tccttgtaagttc |
52618529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 76 - 242
Target Start/End: Complemental strand, 4229248 - 4229082
Alignment:
| Q |
76 |
ctaaatgaatgcgacgtcgtttttagagaaccagaacctctgacacttgccctaaccccctgattcacaaccgcatactcgccggagcaccaccctcaac |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4229248 |
ctaaatgaatgcgacgtcgtttttagagaaccagaacctctgacacttgccctaaccccctgattcacaaccgcatactcgccggagcaccaccctcaac |
4229149 |
T |
 |
| Q |
176 |
gttgcgtcgttcacgcaaactcgccgggaaagtcaccatcatcaaatcctccttgtaagttcatctc |
242 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4229148 |
gttgcgtcgctcacgcaaactcgccgggaaagtcaccatcatcaaatcctccttgtaagttcttctc |
4229082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University