View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1999_low_70 (Length: 236)
Name: NF1999_low_70
Description: NF1999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1999_low_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 80 - 216
Target Start/End: Original strand, 2578794 - 2578930
Alignment:
| Q |
80 |
aattttaatatttcaaaagattccttcttcatattttattagaactagaatttcaacacattccttcttagtagtattttattagagctagaacttaact |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2578794 |
aattttaatatttcaaaagattccttcttcatattttattagaactagaatttcaacacattccttcttagtagtattttattagagctagaacttaact |
2578893 |
T |
 |
| Q |
180 |
ttggtatgaataaaacatagttatactattgaaattt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2578894 |
ttggtatgaataaaacatagttatactattgaaattt |
2578930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University