View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1999_low_71 (Length: 235)
Name: NF1999_low_71
Description: NF1999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1999_low_71 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 10 - 217
Target Start/End: Original strand, 32184297 - 32184504
Alignment:
| Q |
10 |
catcatcatgagagtggtaaagtttggaaaaggaagatgcatggggcagttgtggggcttttgctatgtctcagccactcatagatatgagtggatatga |
109 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32184297 |
catcaacatgagagtggtaaagtt-ggaaaaggaagatgtatggggcagttgtggggcttttgctatgtctcagccactcatagatacgagtggatatga |
32184395 |
T |
 |
| Q |
110 |
cgtttccaattgtgacctcaatgcatactaggatattagtttgccacatcagctaaaaataattctatgcc-acaaagccatgtttcttgctttggctag |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32184396 |
cgtttccaattgtgacctcaatgcatactaggatattagtttgccacatcagctaaaaataattctatgccaacaaagccatgtttcttgctttggctag |
32184495 |
T |
 |
| Q |
209 |
tggttgatc |
217 |
Q |
| |
|
||||||||| |
|
|
| T |
32184496 |
tggttgatc |
32184504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University