View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1999_low_73 (Length: 232)
Name: NF1999_low_73
Description: NF1999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1999_low_73 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 14 - 215
Target Start/End: Original strand, 43424427 - 43424628
Alignment:
| Q |
14 |
aagaatatgatttgattattttgaaggatcaactaatctatatagatatataattgatttttgtgttaatttttgatgattttggaaaatataggaatgg |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43424427 |
aagaaaatgatttgattattttgaaggatcaactaatctatatagatatataattgatttttgtgttaatttttgatgattttggaaaatataggaatgg |
43424526 |
T |
 |
| Q |
114 |
tgtggtgtatgaagaagggaaggctagtatgctaagtcagcctccttcaaatgcttctcttgttgatcatgttaaacaagaaagttcagtgaacaactat |
213 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43424527 |
tgtggtgtatgaagaagagaaggctagtatgctaagtcagcctccttcaaatgcttctcttgttgatcatgttaaacaagaaagttcagtgaacaactat |
43424626 |
T |
 |
| Q |
214 |
gt |
215 |
Q |
| |
|
|| |
|
|
| T |
43424627 |
gt |
43424628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University