View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1999_low_76 (Length: 219)
Name: NF1999_low_76
Description: NF1999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1999_low_76 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 31515408 - 31515224
Alignment:
| Q |
18 |
cactggtggaaaatagtttagtatgattcacaccaactatgtttatatatttacttggttaatgatcttatatctttagtttaaaaaatacgacatgtta |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
31515408 |
cactggtggaaaatagtttagtatgactcacaccaactatgtttatatatttacatggttaatgatcttatatctttagtttcaaaaatacgacttgtta |
31515309 |
T |
|
| Q |
118 |
tttttggtgtttcaattcatcaattgtattataataatgtaatttcattaaattttaaaataaaagtgtttaaaaatctgtccct |
202 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
31515308 |
tttttagtgtttcaattcatcaattgtattataataatataatttcattaaattttaaaataaaagtgttttaaaatttgtccct |
31515224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 31524156 - 31524123
Alignment:
| Q |
18 |
cactggtggaaaatagtttagtatgattcacacc |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31524156 |
cactggtggaaaatagtttagtatgattcacacc |
31524123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University