View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20000_low_10 (Length: 236)
Name: NF20000_low_10
Description: NF20000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20000_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 9970350 - 9970568
Alignment:
| Q |
1 |
aaaaaatataacattgtttcgtgtt-tatgaacaataaaatatcatttacaagtttcgtgtcatattagaattactcgtgcacttattcctttctctgat |
99 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9970350 |
aaaaaatataacattgtttcgtgttatatgaacaataaaatatcctttacaagtttcgtgtcatattagaattactcgtacacttattcctttctctgat |
9970449 |
T |
|
| Q |
100 |
ggtgataggcaatgctttccattcttttctaaattcattcacattgacatatctgctttatctttgaatatctaaatgaaggatcctaccagagtgtctc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9970450 |
agtgataggcaatgctttccattcttttctaa----attcacattgacatatctgctttatctttgaatatctaaatgaaggatcctaccagagtgtctc |
9970545 |
T |
|
| Q |
200 |
atgacatgtaagatcaatctttt |
222 |
Q |
| |
|
||| ||| ||||||||||||||| |
|
|
| T |
9970546 |
atgtcatataagatcaatctttt |
9970568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University