View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20001_high_15 (Length: 351)
Name: NF20001_high_15
Description: NF20001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20001_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 280; Significance: 1e-157; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 19 - 339
Target Start/End: Original strand, 31693554 - 31693874
Alignment:
| Q |
19 |
gttccacttatctatactgagccatgggagatacttcttaaggtatccctcttacaataaaacannnnnnnaagatgtttgcttccacttttattgaatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
31693554 |
gttccacttatctatactgagccatgggagatacttcttaaggtatccctcttacaataaaacatttttttaagatgtttgcttccacttttattgattc |
31693653 |
T |
 |
| Q |
119 |
tttgacatgtttaaatattaccgagagtaattgattttgtctataaaattgatttcaccccgcactttttattgctgacgaaggaatttcgatgactgga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31693654 |
tttgacatgtttaaatattaccgagagtaattgattttgtctataaaattgatttcaccccgcactttttattgctgacgaaggaattttgatgactgga |
31693753 |
T |
 |
| Q |
219 |
ccttgccatatggcacttagttgccatgtcattaatgatcgagtgcaacgtgaccgcgatattaaaccttaagtttgttaatgattccattaagaaacat |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31693754 |
ccttgccatatggcacttagttgccatgtcattaatgattgagtacaacgtgaccgcgatattaaaccttaagtttgttaatgattccattaagaaacac |
31693853 |
T |
 |
| Q |
319 |
cggacaaatgattctctcctt |
339 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
31693854 |
cggacaaatgattctctcctt |
31693874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 19 - 65
Target Start/End: Original strand, 31687491 - 31687537
Alignment:
| Q |
19 |
gttccacttatctatactgagccatgggagatacttcttaaggtatc |
65 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||| |||||||| |
|
|
| T |
31687491 |
gttccacttatatatactgagccatgggagatccttcgcaaggtatc |
31687537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University