View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20001_high_16 (Length: 349)
Name: NF20001_high_16
Description: NF20001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20001_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 6 - 333
Target Start/End: Complemental strand, 54154230 - 54153903
Alignment:
| Q |
6 |
gaggagaagcaaaggataatttctgtttgttttcttcttttgtttatgagtcaaccttgactcttcttcgtccgatttattgaatctactccttttccga |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54154230 |
gaggagattcaaaggataatttctgtttgttttcttcttttgtttatgagtcaaccttgactcttcttcgtccgatttattgaatctactccttttccga |
54154131 |
T |
|
| Q |
106 |
ctaggcaaattggatttgcgattcttttcgattatcattgttgaataaaggaatcaaaaatcaaattaggcattaatcaaatgtcggattctcatctcca |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54154130 |
ctaggcaaattggatttgcgattcttttcgattatcattgttgaaaaaaggaatcaaaaatcaaattaggcattaatcaaatgtcggattctcatctcca |
54154031 |
T |
|
| Q |
206 |
tgggtttcttctctcttttttcttatgggtttctcagtcacctataaattaaaattagaaacaggaaatccaaatccattttttaatgtgattttcatcg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54154030 |
tgggtttcttctctcttttttcttatgggtttctcagtcacctataaattaaaattagaaacaggaaatccaaatccattttttaatgtgattttcatcg |
54153931 |
T |
|
| Q |
306 |
cccctttgttaatgatattggttatttg |
333 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
54153930 |
cccctttgttaatgatattggttatttg |
54153903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University