View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20001_low_24 (Length: 341)
Name: NF20001_low_24
Description: NF20001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20001_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 3 - 329
Target Start/End: Complemental strand, 5419333 - 5419007
Alignment:
| Q |
3 |
gttggtttattggtttcttcatttgtgtttagtggaattttgatcaagtatttcgtggagaaaccgattcggatgaatgaagttttgaatttcgattata |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5419333 |
gttggtttattggtttcttcatttgtgtttagtggaattttgatcaagtatttcgtggagaaaccgattcggatgaatgaagttttgaatttcgattata |
5419234 |
T |
|
| Q |
103 |
ctaagcttagtcctgtggcttatgttccgattatttcgtgtgatggtgttgttatgggaaaagattatgagggtggttttgaagttgggaaggggatgat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5419233 |
ctaagcttagtcctgtggcttatgttccgattatttcgtgtgatggtgttgttaagggaaaagattatgagggtggttttgaagttgggaaggggatgat |
5419134 |
T |
|
| Q |
203 |
gatgggtgaaagggttatacctactagacataaagtgcaagttactgtttccttgagagtgccggagtcgggatataacagaaatcttggggtctttcag |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5419133 |
gatgggtgaaagggttatacctactagacataaagtgcaagttactgtttcgttgagagtgccggagtcgggatataacagaaatcttggggtctttcag |
5419034 |
T |
|
| Q |
303 |
gtgattgcttatctctatccggttcat |
329 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
5419033 |
gtgattgcttatctctatccggttcat |
5419007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University