View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20001_low_25 (Length: 321)
Name: NF20001_low_25
Description: NF20001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20001_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 60 - 306
Target Start/End: Complemental strand, 49929209 - 49928963
Alignment:
| Q |
60 |
atttgcaaattgcaactatatttgcctttaccagatgatattgtagtgcaacatcataatcatttatgaaattcatccatcttctttgcctcgtgtttaa |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49929209 |
atttgcaaattgcaactatatttgcctttaccagatgatattgtagtgcaaaatcataatcatttatgaaattcatccatcttctttgcctcgtgtttaa |
49929110 |
T |
 |
| Q |
160 |
ctcattttggtcaaacaagtacttccaactcaggataccctttgcgagtcataaccggtttaactttcatggtttgcttgtacctttccaatatgccaca |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49929109 |
ctcattttggtcaaacaagtacttccaactcaggataccctttgcgagtcataaccggtttaactttcatggttcgcttgtacctttccaatatgccaca |
49929010 |
T |
 |
| Q |
260 |
ttttatcctccggtgcacttcaccactcagcaactcatcttctcctt |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49929009 |
ttttatcctccggtgcacttcaccactcagcaactcatcttctcctt |
49928963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 6 - 61
Target Start/End: Complemental strand, 49929287 - 49929232
Alignment:
| Q |
6 |
agtagcaaaggcttgaatatgggatacctgttcatcagctgacattgtttccatat |
61 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49929287 |
agtagctaaggcttgaatatgggatacctgttcatcagctgacattgtttccatat |
49929232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 71; Significance: 4e-32; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 69 - 298
Target Start/End: Complemental strand, 16437924 - 16437692
Alignment:
| Q |
69 |
ttgcaactatatttgcctttaccagatgatattgtagtgcaacatcataatcatttatgaaattcatccatcttctttgcctcgtgtttaactcattttg |
168 |
Q |
| |
|
|||||||||| |||| |||| | ||||||||||| ||||| || ||||||||||||||||||||||||||| |||||||| || |||||| ||||| |
|
|
| T |
16437924 |
ttgcaactatttttgtcttttcggaatgatattgtactgcaaaattgtaatcatttatgaaattcatccatcttgtttgcctcatgcataactccttttg |
16437825 |
T |
 |
| Q |
169 |
gtcaaacaagtacttccaactcaggatac---cctttgcgagtcataaccggtttaactttcatggtttgcttgtacctttccaatatgccacattttat |
265 |
Q |
| |
|
|||||| |||||||| |||||||||||| || ||| |||| |||| || ||||||||||| ||| | | |||| |||||| |||| | ||||||| |
|
|
| T |
16437824 |
gtcaaataagtactttaaactcaggataccgaccgatgcaagtcgtaacttgtataactttcatgatttacctatacccttccaacatgcaatattttat |
16437725 |
T |
 |
| Q |
266 |
cctccggtgcacttcaccactcagcaactcatc |
298 |
Q |
| |
|
||| |||||||||||||||||| |||| |||| |
|
|
| T |
16437724 |
tctctggtgcacttcaccactcatcaacccatc |
16437692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 133 - 180
Target Start/End: Original strand, 18865782 - 18865829
Alignment:
| Q |
133 |
catccatcttctttgcctcgtgtttaactcattttggtcaaacaagta |
180 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||| ||||||||||| |
|
|
| T |
18865782 |
catccatcttctttgtctcatgtttaactccttttgatcaaacaagta |
18865829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University