View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20001_low_28 (Length: 269)
Name: NF20001_low_28
Description: NF20001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20001_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 219
Target Start/End: Complemental strand, 2252544 - 2252341
Alignment:
| Q |
16 |
caaatttctggttatatcattatctccagaagatagttgatagaaaatcagtccttatctttgttatttatgttgttcatttatagaaataccgtacttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2252544 |
caaatttctggttatatcattatctccagaagatagttgataggaaatcagtccttatctttgttatttatgttgttcatttatagaaataccgtacttg |
2252445 |
T |
|
| Q |
116 |
caatattcgtctaatttataaagctgattgcactaaattctgttagggaaactgttccaacttgtttttatgataaactggctagccagacacagtatat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2252444 |
caatattcgtctaatttataaagctgattgcaccaaattctgttagggaaactgttccaacttgtttttatgataaactggctagccagacacagtatat |
2252345 |
T |
|
| Q |
216 |
gtga |
219 |
Q |
| |
|
|||| |
|
|
| T |
2252344 |
gtga |
2252341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 45 - 107
Target Start/End: Original strand, 18948404 - 18948467
Alignment:
| Q |
45 |
aagatagttgatagaaaatcagtccttatcttt-gttatttatgttgttcatttatagaaatac |
107 |
Q |
| |
|
|||||| |||||| ||||||| ||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
18948404 |
aagatatttgataaaaaatcaatccttatcttttgttatttatattgttcatttatagaaatac |
18948467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University