View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20001_low_29 (Length: 261)
Name: NF20001_low_29
Description: NF20001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20001_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 41 - 245
Target Start/End: Complemental strand, 9439847 - 9439643
Alignment:
| Q |
41 |
cttccatttgatcaataagatacatcatatcaaagttgatcaaatggtaagactttttgatcaaataccggaaacaatatttaatgtatactcaactgaa |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9439847 |
cttccatttgatcaataagatacatcatatcaaagttgatcaaatggtaagactttttgatcaaataccggaaacaatatttaatgtatactcaactgaa |
9439748 |
T |
|
| Q |
141 |
ttaacgacaattttacatgtgattaaatagtggtggtatgggtagggaaacatgtttgtccatgaaacgtttttgttaagttttcttttgttaacatcca |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9439747 |
ttaacgacaattttacatgtgattaaatagtggtggtatgggtagggaaacttgtttgtccatgaaacgtttttgttaagttttcttttgttaacatcca |
9439648 |
T |
|
| Q |
241 |
ataga |
245 |
Q |
| |
|
||||| |
|
|
| T |
9439647 |
ataga |
9439643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 129 - 166
Target Start/End: Complemental strand, 33742846 - 33742809
Alignment:
| Q |
129 |
tactcaactgaattaacgacaattttacatgtgattaa |
166 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
33742846 |
tactcaaccgaattaaccacaattttacatgtgattaa |
33742809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University