View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20001_low_34 (Length: 237)
Name: NF20001_low_34
Description: NF20001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20001_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 48481985 - 48482205
Alignment:
| Q |
1 |
gcttctaaatagatattatattctacatttttgtagtcttgatttgttggtactattggcatgatttgtctgaagccaagtattttgtatgattttggtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48481985 |
gcttctaaatagatattatattctacatttttgtagtcttgatttgttggtactattggtatgatttgtctgaagccaagtattttgtatgattttggtt |
48482084 |
T |
 |
| Q |
101 |
ccctaacaaatcaaaaatataattatttttccatatggcaaaaaggttttcaaatcttatttttctttttgttcaaatcttgttttagtttaattgcaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48482085 |
ccctaacaaatcaaaaatataattatttttctatatggcaaataggttttcaaatcttatttttctttttgttcaaatcctgttttagtttaattgcaag |
48482184 |
T |
 |
| Q |
201 |
agagagcctgaaggttctcct |
221 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
48482185 |
agagagtctgaaggttctcct |
48482205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 54 - 90
Target Start/End: Original strand, 11267821 - 11267857
Alignment:
| Q |
54 |
tattggcatgatttgtctgaagccaagtattttgtat |
90 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
11267821 |
tattggcatgatttgtttgaagcctagtattttgtat |
11267857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University